Transcript: Human NM_001134832.1

Homo sapiens Abelson helper integration site 1 (AHI1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
AHI1 (54806)
Length:
3674
CDS:
300..3461

Additional Resources:

NCBI RefSeq record:
NM_001134832.1
NBCI Gene record:
AHI1 (54806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134832.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135184 CGGCCTGTTTCATCTTACTAT pLKO.1 1455 CDS 100% 5.625 7.875 N AHI1 n/a
2 TRCN0000137208 GCTTGCCGTATCCCAAACAAA pLKO.1 2079 CDS 100% 5.625 4.500 N AHI1 n/a
3 TRCN0000162243 CCCGGTTTATCCCAAATGTTT pLKO.1 1292 CDS 100% 5.625 3.938 N AHI1 n/a
4 TRCN0000163036 GCCATATTGGTCCGACAGTTT pLKO.1 2499 CDS 100% 4.950 3.465 N AHI1 n/a
5 TRCN0000159711 GTCTAAGTTAAAGCAGTCAAA pLKO.1 3338 CDS 100% 4.950 3.465 N AHI1 n/a
6 TRCN0000136362 CCATGTATTCTGACTTGCCAT pLKO.1 2935 CDS 100% 2.640 1.848 N AHI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134832.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.