Transcript: Human NM_001134836.2

Homo sapiens signal regulatory protein beta 2 (SIRPB2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SIRPB2 (284759)
Length:
2385
CDS:
62..796

Additional Resources:

NCBI RefSeq record:
NM_001134836.2
NBCI Gene record:
SIRPB2 (284759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363306 ATGCAGGTTCAGCAACTATAA pLKO_005 1287 3UTR 100% 13.200 18.480 N SIRPB2 n/a
2 TRCN0000363347 GCTGGCTTGGGCAGGTATAAT pLKO_005 1260 3UTR 100% 15.000 12.000 N SIRPB2 n/a
3 TRCN0000052757 GAACACCTTAGCATGGAGCAA pLKO.1 763 CDS 100% 2.640 2.112 N SIRPB2 n/a
4 TRCN0000363253 TGAGGATGCAGGCACCTATTA pLKO_005 469 CDS 100% 13.200 9.240 N SIRPB2 n/a
5 TRCN0000052754 CGGGAGGCCATTTACAACTTT pLKO.1 368 CDS 100% 5.625 3.938 N SIRPB2 n/a
6 TRCN0000052755 GCAGGCACCTATTACTGTGTA pLKO.1 476 CDS 100% 4.950 3.465 N SIRPB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.