Transcript: Human NM_001134888.2

Homo sapiens retrotransposon Gag like 1 (RTL1), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
RTL1 (388015)
Length:
4193
CDS:
60..4136

Additional Resources:

NCBI RefSeq record:
NM_001134888.2
NBCI Gene record:
RTL1 (388015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247654 CACCAGGAGTCCATCGAATTT pLKO_005 1515 CDS 100% 13.200 18.480 N RTL1 n/a
2 TRCN0000247655 GGAGATCAGGCACTATCTATT pLKO_005 1055 CDS 100% 13.200 18.480 N RTL1 n/a
3 TRCN0000247653 CCGAAGTCGACTGGATCAAAG pLKO_005 1600 CDS 100% 10.800 15.120 N RTL1 n/a
4 TRCN0000188281 CCGGAACTGTTTGACCAGTTA pLKO.1 2010 CDS 100% 0.495 0.693 N RTL1 n/a
5 TRCN0000247656 AGACCTGGCCGACGTGTTTAA pLKO_005 1739 CDS 100% 13.200 10.560 N RTL1 n/a
6 TRCN0000247657 AGAACGTCATGACCATCATAA pLKO_005 2431 CDS 100% 13.200 9.240 N RTL1 n/a
7 TRCN0000202864 CTACCCAAGAATGTTCTATAA pLKO.1 737 CDS 100% 13.200 9.240 N RTL1 n/a
8 TRCN0000186849 GCTACCCAAGAATGTTCTATA pLKO.1 736 CDS 100% 13.200 9.240 N RTL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.