Transcript: Mouse NM_001135115.1

Mus musculus predicted gene 12250 (Gm12250), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Gm12250 (631323)
Length:
2702
CDS:
263..1516

Additional Resources:

NCBI RefSeq record:
NM_001135115.1
NBCI Gene record:
Gm12250 (631323)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001135115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270963 ACAGCGCAAACAGGTATATTA pLKO_005 2487 3UTR 100% 15.000 10.500 N Gm12250 n/a
2 TRCN0000270890 TAAACCCAGTTCCTACAATAG pLKO_005 844 CDS 100% 10.800 7.560 N Gm12250 n/a
3 TRCN0000270962 TCATCTCATCTGCTCGCTTTA pLKO_005 720 CDS 100% 10.800 7.560 N Gm12250 n/a
4 TRCN0000270892 TGCAGTGCCTCCCTACCATTA pLKO_005 1038 CDS 100% 10.800 7.560 N Gm12250 n/a
5 TRCN0000270964 CAGGGAAGTCCACGTTCATTA pLKO_005 498 CDS 100% 13.200 7.920 N Gm12250 n/a
6 TRCN0000201485 CCTCTTGAGTGCTGGGATTAA pLKO.1 1860 3UTR 100% 13.200 6.600 Y D830050J10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.