Transcript: Human NM_001135597.2

Homo sapiens coiled-coil domain containing 88A (CCDC88A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CCDC88A (55704)
Length:
9748
CDS:
778..6390

Additional Resources:

NCBI RefSeq record:
NM_001135597.2
NBCI Gene record:
CCDC88A (55704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135597.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148820 CCGCACATATTCAAGAGGTAA pLKO.1 1247 CDS 100% 4.950 6.930 N CCDC88A n/a
2 TRCN0000148551 CTTCATTAGTTCTGCGGGAAA pLKO.1 6069 CDS 100% 4.050 5.670 N CCDC88A n/a
3 TRCN0000176792 CCAAGCAGTTGGTTAATAATA pLKO.1 5423 CDS 100% 15.000 12.000 N Ccdc88a n/a
4 TRCN0000129915 GCAAGCTAAGCAAGATTGAAT pLKO.1 2579 CDS 100% 5.625 4.500 N CCDC88A n/a
5 TRCN0000149922 GCTGCTTTAGAAGCTCGATTA pLKO.1 3703 CDS 100% 10.800 7.560 N CCDC88A n/a
6 TRCN0000149844 CCAGAATGTACCGAGATGAAT pLKO.1 1691 CDS 100% 5.625 3.938 N CCDC88A n/a
7 TRCN0000130452 GCTTTCATTACCAGCTCTGAA pLKO.1 7680 3UTR 100% 4.950 3.465 N CCDC88A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135597.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.