Transcript: Human NM_001135654.2

Homo sapiens poly(A) binding protein cytoplasmic 4 (PABPC4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PABPC4 (8761)
Length:
3055
CDS:
840..2735

Additional Resources:

NCBI RefSeq record:
NM_001135654.2
NBCI Gene record:
PABPC4 (8761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135654.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344879 CAGGGAAGGCCTCCATATTAT pLKO_005 2088 CDS 100% 15.000 21.000 N PABPC4 n/a
2 TRCN0000293719 AGAACGGCAGGCAGAGTTAAA pLKO_005 1649 CDS 100% 13.200 9.240 N PABPC4 n/a
3 TRCN0000298543 GTGGGCTCCAAGCCACTATAT pLKO_005 1911 CDS 100% 13.200 9.240 N PABPC4 n/a
4 TRCN0000293720 CAGGAGAGAATTAGTCGATAT pLKO_005 1692 CDS 100% 10.800 7.560 N PABPC4 n/a
5 TRCN0000074662 CAAGGCACTTTATGATACTTT pLKO.1 1175 CDS 100% 5.625 3.938 N PABPC4 n/a
6 TRCN0000074658 CCTCAACACCAAGGATTACAA pLKO.1 2820 3UTR 100% 5.625 3.938 N PABPC4 n/a
7 TRCN0000286211 CCTCAACACCAAGGATTACAA pLKO_005 2820 3UTR 100% 5.625 3.938 N PABPC4 n/a
8 TRCN0000074661 CAAAGTATTTGTGGGCAGATT pLKO.1 1337 CDS 100% 4.950 3.465 N PABPC4 n/a
9 TRCN0000074659 GCCTCCATATTATACACCTAA pLKO.1 2096 CDS 100% 4.950 3.465 N PABPC4 n/a
10 TRCN0000074660 GCTAAGGTAATGCTGGAGGAT pLKO.1 1806 CDS 100% 2.640 1.848 N PABPC4 n/a
11 TRCN0000286273 GCTAAGGTAATGCTGGAGGAT pLKO_005 1806 CDS 100% 2.640 1.848 N PABPC4 n/a
12 TRCN0000102379 CCAAGGAATTCACCAATGTTT pLKO.1 1399 CDS 100% 0.000 0.000 N Pabpc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135654.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.