Transcript: Mouse NM_001135657.1

Mus musculus protein tyrosine phosphatase, receptor type, J (Ptprj), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ptprj (19271)
Length:
4201
CDS:
56..3955

Additional Resources:

NCBI RefSeq record:
NM_001135657.1
NBCI Gene record:
Ptprj (19271)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001135657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236758 TGCGGCACCGAATCCTATATT pLKO_005 223 CDS 100% 15.000 21.000 N Ptprj n/a
2 TRCN0000220439 CCGAATCCTATATTTGACATT pLKO.1 230 CDS 100% 4.950 6.930 N Ptprj n/a
3 TRCN0000220440 CCTCGGATACTTATGTCACAT pLKO.1 2448 CDS 100% 4.950 6.930 N Ptprj n/a
4 TRCN0000236757 CAGGACGGAAGTCGCCTATTT pLKO_005 2143 CDS 100% 13.200 10.560 N Ptprj n/a
5 TRCN0000220441 CGTCAACCAAACTGTCAATAA pLKO.1 1045 CDS 100% 13.200 10.560 N Ptprj n/a
6 TRCN0000081297 CGGCAATGACAATCTATGAAA pLKO.1 3759 CDS 100% 5.625 4.500 N LOC433453 n/a
7 TRCN0000236759 ACATCCGGGTGGTCAACATTA pLKO_005 1452 CDS 100% 13.200 9.240 N Ptprj n/a
8 TRCN0000081296 CCAACACTTTGAAAGATTTCT pLKO.1 3165 CDS 100% 5.625 3.938 N LOC433453 n/a
9 TRCN0000220442 CGGAGCAGTGTTTGGATGTAT pLKO.1 2737 CDS 100% 5.625 3.938 N Ptprj n/a
10 TRCN0000081295 GCCATTGTTATGTTGACCAAA pLKO.1 3215 CDS 100% 4.950 3.465 N LOC433453 n/a
11 TRCN0000236761 TTGCTGGCTTTACCAATATTA pLKO_005 2610 CDS 100% 15.000 9.000 N Ptprj n/a
12 TRCN0000081294 CGGGATTACATGAAGCAGATA pLKO.1 3482 CDS 100% 4.950 2.970 N LOC433453 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.