Transcript: Human NM_001136021.3

Homo sapiens nuclear factor of activated T cells 2 (NFATC2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NFATC2 (4773)
Length:
7449
CDS:
211..2916

Additional Resources:

NCBI RefSeq record:
NM_001136021.3
NBCI Gene record:
NFATC2 (4773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230219 ACGGAGCCCACGGATGAATAT pLKO_005 2197 CDS 100% 13.200 18.480 N NFATC2 n/a
2 TRCN0000016143 CCGAGTCCAAAGTTGTGTTTA pLKO.1 1964 CDS 100% 13.200 18.480 N NFATC2 n/a
3 TRCN0000016145 GCACATCATGTACTGCGAGAA pLKO.1 2637 CDS 100% 4.050 5.670 N NFATC2 n/a
4 TRCN0000016144 CGCCAATAATGTCACCTCGAA pLKO.1 800 CDS 100% 2.640 3.696 N NFATC2 n/a
5 TRCN0000217956 GTGATCTTTGATCCGAGAAAT pLKO_005 2929 3UTR 100% 13.200 10.560 N NFATC2 n/a
6 TRCN0000230217 AGCTGATGAGCGGATCCTTAA pLKO_005 1536 CDS 100% 10.800 8.640 N NFATC2 n/a
7 TRCN0000016147 GTGAACTTCTACGTCATCAAT pLKO.1 2116 CDS 100% 5.625 4.500 N NFATC2 n/a
8 TRCN0000230218 AGCTTAGAAACGCCGACATTG pLKO_005 1709 CDS 100% 10.800 7.560 N NFATC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.