Transcript: Human NM_001136265.2

Homo sapiens intermediate filament family orphan 2 (IFFO2), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
IFFO2 (126917)
Length:
6179
CDS:
345..1898

Additional Resources:

NCBI RefSeq record:
NM_001136265.2
NBCI Gene record:
IFFO2 (126917)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253659 TGACTATGTGTGATGTAATTT pLKO_005 3571 3UTR 100% 15.000 12.000 N IFFO2 n/a
2 TRCN0000253661 TGCGGGAGACCTTTGACTTTG pLKO_005 1447 CDS 100% 10.800 7.560 N IFFO2 n/a
3 TRCN0000253662 AGGAGTACCAGGAAACGATAG pLKO_005 1630 CDS 100% 6.000 4.200 N IFFO2 n/a
4 TRCN0000253660 CTTGATCCATGAGACCGAATC pLKO_005 1589 CDS 100% 6.000 4.200 N IFFO2 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4740 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.