Transcript: Human NM_001136536.5

Homo sapiens death domain containing 1 (DTHD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
DTHD1 (401124)
Length:
5935
CDS:
398..2248

Additional Resources:

NCBI RefSeq record:
NM_001136536.5
NBCI Gene record:
DTHD1 (401124)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136536.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283761 TGAATCAATCTCTCGTAATTA pLKO_005 1794 CDS 100% 15.000 21.000 N DTHD1 n/a
2 TRCN0000268684 AGTTAGTTAGCAACGTCATAA pLKO_005 549 CDS 100% 13.200 18.480 N DTHD1 n/a
3 TRCN0000283763 TAGGATTACACCTTCGTATTT pLKO_005 1144 CDS 100% 13.200 18.480 N DTHD1 n/a
4 TRCN0000283762 CAACTAGAATGCCGGATAATA pLKO_005 491 CDS 100% 15.000 10.500 N DTHD1 n/a
5 TRCN0000268685 CTGGAAGTTTCCGAATGATAT pLKO_005 2319 3UTR 100% 13.200 9.240 N DTHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136536.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10127 pDONR223 100% 78.1% 78.1% None (many diffs) n/a
2 ccsbBroad304_10127 pLX_304 0% 78.1% 78.1% V5 (many diffs) n/a
Download CSV