Transcript: Human NM_001137668.2

Homo sapiens caspase 8 associated protein 2 (CASP8AP2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
CASP8AP2 (9994)
Length:
6659
CDS:
84..6032

Additional Resources:

NCBI RefSeq record:
NM_001137668.2
NBCI Gene record:
CASP8AP2 (9994)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001137668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229317 GGCATAGTTGATCGTTTATTT pLKO_005 3423 CDS 100% 15.000 21.000 N CASP8AP2 n/a
2 TRCN0000061764 CCAGTGTATAATAACAGTCAT pLKO.1 2721 CDS 100% 4.950 6.930 N CASP8AP2 n/a
3 TRCN0000218500 GATGTTCTGGAGGCAATTTAA pLKO_005 5218 CDS 100% 15.000 10.500 N CASP8AP2 n/a
4 TRCN0000218719 AGAGTCTTCAATGCAAGTTAA pLKO_005 1865 CDS 100% 13.200 9.240 N CASP8AP2 n/a
5 TRCN0000061763 GCCAGGATCAAATTGTGATAA pLKO.1 5528 CDS 100% 13.200 9.240 N CASP8AP2 n/a
6 TRCN0000218984 GGAAACCAAGTCAACGTTATT pLKO_005 1958 CDS 100% 13.200 9.240 N CASP8AP2 n/a
7 TRCN0000229318 TGGGACTCTTAACTGATATTG pLKO_005 6046 3UTR 100% 13.200 9.240 N CASP8AP2 n/a
8 TRCN0000061766 GCCAATTTACAAATCTGACAA pLKO.1 2816 CDS 100% 4.950 3.465 N CASP8AP2 n/a
9 TRCN0000061765 GCGAGTCTATACCAGCTTGTA pLKO.1 4135 CDS 100% 4.950 3.465 N CASP8AP2 n/a
10 TRCN0000061767 CCAGTCTCTTAAGAAGAATAT pLKO.1 407 CDS 100% 13.200 7.920 N CASP8AP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001137668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.