Transcript: Human NM_001142549.1

Homo sapiens DEAD-box helicase 4 (DDX4), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-12-23
Taxon:
Homo sapiens (human)
Gene:
DDX4 (54514)
Length:
2778
CDS:
100..2172

Additional Resources:

NCBI RefSeq record:
NM_001142549.1
NBCI Gene record:
DDX4 (54514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051153 GCGAGATAATACATCCACAAT pLKO.1 324 CDS 100% 4.950 6.930 N DDX4 n/a
2 TRCN0000051154 GCTCGTTGAAATTCTGCGAAA pLKO.1 1587 CDS 100% 4.050 5.670 N DDX4 n/a
3 TRCN0000051155 GCACATTATCAGACAGGCATA pLKO.1 775 CDS 100% 4.050 3.240 N DDX4 n/a
4 TRCN0000051157 CCTTCTACCATTGATGAATAT pLKO.1 1849 CDS 100% 13.200 9.240 N DDX4 n/a
5 TRCN0000051156 GCAGGTTTGAAGATGGTGATA pLKO.1 395 CDS 100% 4.950 3.465 N DDX4 n/a
6 TRCN0000103711 GCCCAGTTCTTGTTGCTACTT pLKO.1 1769 CDS 100% 4.950 3.465 N Ddx4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.