Transcript: Human NM_001142595.1

Homo sapiens prolyl 4-hydroxylase subunit alpha 1 (P4HA1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
P4HA1 (5033)
Length:
2953
CDS:
335..1939

Additional Resources:

NCBI RefSeq record:
NM_001142595.1
NBCI Gene record:
P4HA1 (5033)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303934 ATTTGAGCTATGCGGTATATC pLKO_005 963 CDS 100% 13.200 18.480 N P4HA1 n/a
2 TRCN0000061998 GCGAGATTTCTACCATAGATA pLKO.1 924 CDS 100% 5.625 7.875 N P4HA1 n/a
3 TRCN0000061999 CCTCGTATTATTCGCTTCCAT pLKO.1 1337 CDS 100% 3.000 4.200 N P4HA1 n/a
4 TRCN0000062001 GCAGAGAAGTTAGATCGGCTA pLKO.1 512 CDS 100% 2.160 1.728 N P4HA1 n/a
5 TRCN0000062000 CCAGTGGAGAAGGAGATTATA pLKO.1 1803 CDS 100% 15.000 10.500 N P4HA1 n/a
6 TRCN0000303933 CCTGTGGTGTCTCGAATTAAT pLKO_005 1508 CDS 100% 15.000 10.500 N P4HA1 n/a
7 TRCN0000303872 AGTAACACGAAATCATCATAT pLKO_005 2115 3UTR 100% 13.200 9.240 N P4HA1 n/a
8 TRCN0000062002 CCAGTGCTAGTTGGCAACAAA pLKO.1 1844 CDS 100% 5.625 3.938 N P4HA1 n/a
9 TRCN0000300172 CCAGTGCTAGTTGGCAACAAA pLKO_005 1844 CDS 100% 5.625 3.938 N P4HA1 n/a
10 TRCN0000303935 CTATACAGAAGCAGATTATTA pLKO_005 856 CDS 100% 15.000 9.000 N P4HA1 n/a
11 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 279 5UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.