Transcript: Human NM_001142640.1

Homo sapiens trinucleotide repeat containing adaptor 6C (TNRC6C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
TNRC6C (57690)
Length:
9794
CDS:
601..5781

Additional Resources:

NCBI RefSeq record:
NM_001142640.1
NBCI Gene record:
TNRC6C (57690)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257400 CTATGGCCGGTACGATTTAAT pLKO_005 4620 CDS 100% 15.000 21.000 N TNRC6C n/a
2 TRCN0000218770 CACTATTAACCTCGCCAATTA pLKO_005 4001 CDS 100% 13.200 18.480 N TNRC6C n/a
3 TRCN0000265247 CACTATTAACCTCGCCAATTA pLKO_005 4001 CDS 100% 13.200 18.480 N Tnrc6c n/a
4 TRCN0000229607 GTTGCGCGCACAATCACTAAT pLKO_005 4153 CDS 100% 13.200 18.480 N TNRC6C n/a
5 TRCN0000251809 GTTGCGCGCACAATCACTAAT pLKO_005 4153 CDS 100% 13.200 18.480 N Tnrc6c n/a
6 TRCN0000229608 TGCTATCCCTGGAGGTCTAAG pLKO_005 4563 CDS 100% 10.800 15.120 N TNRC6C n/a
7 TRCN0000004490 CGAAGGCGAGATAAAGGGATT pLKO.1 1858 CDS 100% 4.050 5.670 N TNRC6C n/a
8 TRCN0000004493 CTGCACTATTAACCTCGCCAA pLKO.1 3998 CDS 100% 2.160 3.024 N TNRC6C n/a
9 TRCN0000004492 GCCTCTTATCACATTCCACCT pLKO.1 5322 CDS 100% 2.160 3.024 N TNRC6C n/a
10 TRCN0000251810 GTGGGCTGGAAAGGGTTATTT pLKO_005 6118 3UTR 100% 15.000 10.500 N Tnrc6c n/a
11 TRCN0000229606 AGAAGGCCGAAGGCGAGATAA pLKO_005 1851 CDS 100% 13.200 9.240 N TNRC6C n/a
12 TRCN0000004494 GCCATCATCAGCACCAGGAGA pLKO.1 5787 3UTR 100% 0.880 0.616 N TNRC6C n/a
13 TRCN0000004491 CCAGCATTCCAACAGTGACAT pLKO.1 1644 CDS 100% 4.950 2.970 N TNRC6C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.