Transcript: Mouse NM_001142647.1

Mus musculus nuclear envelope integral membrane protein 2 (Nemp2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Nemp2 (227094)
Length:
3423
CDS:
54..1319

Additional Resources:

NCBI RefSeq record:
NM_001142647.1
NBCI Gene record:
Nemp2 (227094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001142647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430153 GGTTAACTCAGAGTCATATAT pLKO_005 1735 3UTR 100% 15.000 21.000 N Nemp2 n/a
2 TRCN0000181951 GTAAGCGTGAGTCGAAACATT pLKO.1 477 CDS 100% 5.625 7.875 N Nemp2 n/a
3 TRCN0000181252 CCTGTTCTTTAGGACCAGTAA pLKO.1 1524 3UTR 100% 4.950 6.930 N Nemp2 n/a
4 TRCN0000198375 GCTACAATCAACATTCGCAAA pLKO.1 211 CDS 100% 4.050 5.670 N Nemp2 n/a
5 TRCN0000198486 GTACCGTGTTAGGTATTCTAA pLKO.1 595 CDS 100% 0.000 0.000 N Nemp2 n/a
6 TRCN0000198852 CTCTGAAGGAAACGGACTTAA pLKO.1 163 CDS 100% 13.200 9.240 N Nemp2 n/a
7 TRCN0000182474 GCCAGCACACAGAAAGCATTT pLKO.1 322 CDS 100% 10.800 7.560 N Nemp2 n/a
8 TRCN0000425239 TTCTGTGTCAGACTGCTATTG pLKO_005 191 CDS 100% 10.800 7.560 N Nemp2 n/a
9 TRCN0000181851 GCTGTGGTATGGAAACAGAAT pLKO.1 746 CDS 100% 4.950 3.465 N Nemp2 n/a
10 TRCN0000182809 CGTGAGTCGAAACATTGTGGA pLKO.1 482 CDS 100% 2.640 1.848 N Nemp2 n/a
11 TRCN0000182735 GCCCTGAATGAAGACCTTCAT pLKO.1 1489 3UTR 100% 0.495 0.347 N Nemp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.