Transcript: Mouse NM_001142732.1

Mus musculus tubulin tyrosine ligase-like family, member 3 (Ttll3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ttll3 (101100)
Length:
1450
CDS:
328..1191

Additional Resources:

NCBI RefSeq record:
NM_001142732.1
NBCI Gene record:
Ttll3 (101100)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001142732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191085 CCAAACCTGAGATGGAATTTA pLKO.1 1238 3UTR 100% 15.000 10.500 N Ttll3 n/a
2 TRCN0000248587 TCAAGCAGAAGAAGATCTTTA pLKO_005 371 CDS 100% 13.200 9.240 N Ttll3 n/a
3 TRCN0000248591 ATGTCCCGCATGGTTCGAAAT pLKO_005 640 CDS 100% 10.800 7.560 N Ttll3 n/a
4 TRCN0000191164 CAAAGTAAGTTCCTGTTTCAA pLKO.1 1159 CDS 100% 5.625 3.938 N Ttll3 n/a
5 TRCN0000200873 GATGACAAGAAAGCCTTCATA pLKO.1 865 CDS 100% 5.625 3.938 N Ttll3 n/a
6 TRCN0000091278 GCTGTCTTACAAGCCTCCTTA pLKO.1 22 5UTR 100% 4.950 2.475 Y Arpc4 n/a
7 TRCN0000326316 GCTGTCTTACAAGCCTCCTTA pLKO_005 22 5UTR 100% 4.950 2.475 Y Arpc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.