Transcript: Human NM_001142764.2

Homo sapiens protocadherin related 15 (PCDH15), transcript variant B, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
PCDH15 (65217)
Length:
6968
CDS:
336..6209

Additional Resources:

NCBI RefSeq record:
NM_001142764.2
NBCI Gene record:
PCDH15 (65217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412944 ACTACTAACTCACTCATATAA pLKO_005 6371 3UTR 100% 15.000 21.000 N PCDH15 n/a
2 TRCN0000440549 ACGGTCCAAGCAGCGGATAAT pLKO_005 2079 CDS 100% 13.200 18.480 N PCDH15 n/a
3 TRCN0000055653 CCCACCATAGAACTTTCTTTA pLKO.1 546 CDS 100% 13.200 18.480 N PCDH15 n/a
4 TRCN0000055655 GCCGGTCTACACATTGAAATA pLKO.1 1470 CDS 100% 13.200 18.480 N PCDH15 n/a
5 TRCN0000055657 GCGCATCTCTATGAAGAACTT pLKO.1 4668 CDS 100% 4.950 6.930 N PCDH15 n/a
6 TRCN0000419297 GTGAGCCAGTCATCGTCAATA pLKO_005 1804 CDS 100% 13.200 10.560 N PCDH15 n/a
7 TRCN0000055656 CGCTATGTTCAGGAACAAATT pLKO.1 4152 CDS 100% 13.200 9.240 N PCDH15 n/a
8 TRCN0000055654 GCCCTTCAGAAGTAACAAATA pLKO.1 6097 CDS 100% 13.200 9.240 N PCDH15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.