Transcript: Mouse NM_001142916.1

Mus musculus procollagen lysine, 2-oxoglutarate 5-dioxygenase 2 (Plod2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Plod2 (26432)
Length:
3719
CDS:
238..2514

Additional Resources:

NCBI RefSeq record:
NM_001142916.1
NBCI Gene record:
Plod2 (26432)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001142916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312900 AGGTCTTCGCAGGCTATTATA pLKO_005 2207 CDS 100% 15.000 21.000 N Plod2 n/a
2 TRCN0000349788 AGCCGCATATCGGGTGGTTAT pLKO_005 2089 CDS 100% 10.800 15.120 N Plod2 n/a
3 TRCN0000374480 TGATAAGTTGGATCCCGATAT pLKO_005 1689 CDS 100% 10.800 15.120 N Plod2 n/a
4 TRCN0000076411 GCGGTGATGGAATGAACAGTA pLKO.1 467 CDS 100% 4.950 6.930 N Plod2 n/a
5 TRCN0000076410 CCAAGGTTACACTGGGTGTTT pLKO.1 1124 CDS 100% 4.950 3.960 N Plod2 n/a
6 TRCN0000349787 GGCGCATCCCTGCAGATAAAT pLKO_005 332 CDS 100% 15.000 10.500 N Plod2 n/a
7 TRCN0000076408 GCCTGGTAATATGTTCTTATT pLKO.1 2833 3UTR 100% 13.200 9.240 N Plod2 n/a
8 TRCN0000311994 GCCTGGTAATATGTTCTTATT pLKO_005 2833 3UTR 100% 13.200 9.240 N Plod2 n/a
9 TRCN0000374481 ACCACGATGCCTCAACCTTTA pLKO_005 2297 CDS 100% 10.800 7.560 N Plod2 n/a
10 TRCN0000076409 GCTTCATTTCATCCGAGAGTT pLKO.1 2166 CDS 100% 4.950 3.465 N Plod2 n/a
11 TRCN0000064808 CCACCAAGATTCTCCTGAATT pLKO.1 1007 CDS 100% 0.000 0.000 N PLOD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.