Transcript: Human NM_001143685.2

Homo sapiens carboxylesterase 5A (CES5A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CES5A (221223)
Length:
2177
CDS:
153..1880

Additional Resources:

NCBI RefSeq record:
NM_001143685.2
NBCI Gene record:
CES5A (221223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143685.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046782 CAAGGTGCATTACCCGAAATT pLKO.1 476 CDS 100% 13.200 18.480 N CES5A n/a
2 TRCN0000413287 GCTGCTCTTAGATCAACATAT pLKO_005 452 CDS 100% 13.200 18.480 N CES5A n/a
3 TRCN0000430617 GCTCGAACCGGGAATCCTAAT pLKO_005 1638 CDS 100% 10.800 15.120 N CES5A n/a
4 TRCN0000417435 GCACATCCCGCCTCAGTATTT pLKO_005 1277 CDS 100% 13.200 10.560 N CES5A n/a
5 TRCN0000435670 TAATTTCTCCCGCAATCATTA pLKO_005 1922 3UTR 100% 13.200 10.560 N CES5A n/a
6 TRCN0000046779 CGGGAGCCATAAGTGTTTCTA pLKO.1 832 CDS 100% 5.625 4.500 N CES5A n/a
7 TRCN0000419339 ACAAGCTGCTTTCGCTGATAT pLKO_005 1987 3UTR 100% 13.200 9.240 N CES5A n/a
8 TRCN0000046780 GTCCTCTTTCTTCCTTAACTT pLKO.1 1816 CDS 100% 5.625 3.938 N CES5A n/a
9 TRCN0000046778 CCCTAATTTGTGCCTCCAGAA pLKO.1 422 CDS 100% 4.050 2.835 N CES5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143685.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.