Transcript: Human NM_001143839.4

Homo sapiens phosphodiesterase 2A (PDE2A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PDE2A (5138)
Length:
4115
CDS:
68..2872

Additional Resources:

NCBI RefSeq record:
NM_001143839.4
NBCI Gene record:
PDE2A (5138)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143839.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048777 GAAACTGTCTACACCTACCTA pLKO.1 281 CDS 100% 3.000 4.200 N PDE2A n/a
2 TRCN0000048775 CGCCCATTCTCTCCTATACAA pLKO.1 1690 CDS 100% 5.625 4.500 N PDE2A n/a
3 TRCN0000413507 CTGCAACATCTTTGATCATTT pLKO_005 2272 CDS 100% 13.200 9.240 N PDE2A n/a
4 TRCN0000415360 CTGAACATCCCTGACGCATAT pLKO_005 1472 CDS 100% 10.800 7.560 N PDE2A n/a
5 TRCN0000417079 CTTTCCAGGTGGCCTCGAAAT pLKO_005 2163 CDS 100% 10.800 7.560 N PDE2A n/a
6 TRCN0000048773 GCGGAGCTGATCTACAAAGAA pLKO.1 2513 CDS 100% 5.625 3.938 N PDE2A n/a
7 TRCN0000048776 CCAGAAGGAACAGAAACTCAA pLKO.1 1195 CDS 100% 4.950 3.465 N PDE2A n/a
8 TRCN0000048774 GCAGGACATGAATTTCATCAA pLKO.1 1915 CDS 100% 4.950 3.465 N PDE2A n/a
9 TRCN0000114977 GCCAATGAGATGATGATGTAT pLKO.1 1745 CDS 100% 5.625 3.938 N Pde2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143839.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.