Transcript: Human NM_001143944.1

Homo sapiens LEM domain containing 2 (LEMD2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
LEMD2 (221496)
Length:
2376
CDS:
339..944

Additional Resources:

NCBI RefSeq record:
NM_001143944.1
NBCI Gene record:
LEMD2 (221496)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130667 CTGGATACTGAGCAGTAACAA pLKO.1 407 CDS 100% 5.625 7.875 N LEMD2 n/a
2 TRCN0000437120 GACGTGGGCATCTGGTTGAAA pLKO_005 429 CDS 100% 5.625 7.875 N LEMD2 n/a
3 TRCN0000147862 GCCCAAGAATATATAGCCAAT pLKO.1 345 CDS 100% 4.050 5.670 N LEMD2 n/a
4 TRCN0000127585 CCCTCATTTGAGCAATACTCT pLKO.1 2169 3UTR 100% 3.000 4.200 N LEMD2 n/a
5 TRCN0000147861 GCTGCATGAACTCTACAATTT pLKO.1 248 5UTR 100% 13.200 9.240 N LEMD2 n/a
6 TRCN0000422335 AGCAAATGCATTCCTGTTATG pLKO_005 321 5UTR 100% 10.800 7.560 N LEMD2 n/a
7 TRCN0000431957 TCTCTGACTCAGAGCGATAAG pLKO_005 925 CDS 100% 10.800 7.560 N LEMD2 n/a
8 TRCN0000437345 AGTCTCGTCCTGACACGATTC pLKO_005 1055 3UTR 100% 6.000 4.200 N LEMD2 n/a
9 TRCN0000130733 GAGTGTGGAAATCCAGAGAAT pLKO.1 294 5UTR 100% 4.950 3.465 N LEMD2 n/a
10 TRCN0000192997 GTATGAGATGGTGAAGAAGAT pLKO.1 665 CDS 100% 4.950 3.465 N Lemd2 n/a
11 TRCN0000278757 GTATGAGATGGTGAAGAAGAT pLKO_005 665 CDS 100% 4.950 3.465 N Lemd2 n/a
12 TRCN0000148369 CGAAAGTTAGAAGAGGAGGAA pLKO.1 636 CDS 100% 2.640 1.848 N LEMD2 n/a
13 TRCN0000129897 GAAGAAGATTATAGACGTGGT pLKO.1 677 CDS 100% 2.160 1.512 N LEMD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.