Transcript: Human NM_001143980.1

Homo sapiens coiled-coil domain containing 154 (CCDC154), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CCDC154 (645811)
Length:
2191
CDS:
168..2171

Additional Resources:

NCBI RefSeq record:
NM_001143980.1
NBCI Gene record:
CCDC154 (645811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337291 ATGAGTCCAGCCATCCGACAT pLKO_005 313 CDS 100% 4.050 3.240 N CCDC154 n/a
2 TRCN0000337292 CACGTTTCAGAACCAAATAAT pLKO_005 1769 CDS 100% 15.000 10.500 N CCDC154 n/a
3 TRCN0000337236 CGACAAGTGCCTGCTTCATAA pLKO_005 1592 CDS 100% 13.200 9.240 N CCDC154 n/a
4 TRCN0000337234 GCGACTCAGACCTCAGGATTT pLKO_005 1615 CDS 100% 10.800 7.560 N CCDC154 n/a
5 TRCN0000337294 TCATCCGTGCAGCTGCTAAAG pLKO_005 1701 CDS 100% 10.800 7.560 N CCDC154 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.