Transcript: Human NM_001144004.3

Homo sapiens SLIT and NTRK like family member 2 (SLITRK2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
SLITRK2 (84631)
Length:
3912
CDS:
496..3033

Additional Resources:

NCBI RefSeq record:
NM_001144004.3
NBCI Gene record:
SLITRK2 (84631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152771 GACCAGTTTACGCAGACTTTA pLKO.1 1761 CDS 100% 13.200 18.480 N SLITRK2 n/a
2 TRCN0000151924 CGTACTGAATATCAACTGTGA pLKO.1 615 CDS 100% 2.640 3.696 N SLITRK2 n/a
3 TRCN0000153670 CCAGCCTGTCATCAAATGATT pLKO.1 3732 3UTR 100% 5.625 3.938 N SLITRK2 n/a
4 TRCN0000157924 CCAGGCCGACTACAATTACAT pLKO.1 912 CDS 100% 5.625 3.938 N SLITRK2 n/a
5 TRCN0000157103 GCCACTGGGTATCACTACTTT pLKO.1 3544 3UTR 100% 5.625 3.938 N SLITRK2 n/a
6 TRCN0000151283 CAAGACTGTATCCAAACGAAT pLKO.1 719 CDS 100% 4.950 3.465 N SLITRK2 n/a
7 TRCN0000156913 GCCTCTGACCTTTGATGCTTT pLKO.1 1884 CDS 100% 4.950 3.465 N SLITRK2 n/a
8 TRCN0000153992 CCTTGAACATATTGGAGGGAT pLKO.1 1098 CDS 100% 2.640 1.848 N SLITRK2 n/a
9 TRCN0000152257 CAGACAATGGTCTGAATGTAA pLKO.1 1547 CDS 100% 0.563 0.394 N SLITRK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.