Transcript: Human NM_001144005.3

Homo sapiens SLIT and NTRK like family member 2 (SLITRK2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
SLITRK2 (84631)
Length:
7948
CDS:
518..3055

Additional Resources:

NCBI RefSeq record:
NM_001144005.3
NBCI Gene record:
SLITRK2 (84631)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419246 CAATTGCTAAGAGCCTAATTT pLKO_005 6222 3UTR 100% 15.000 21.000 N TMEM257 n/a
2 TRCN0000152771 GACCAGTTTACGCAGACTTTA pLKO.1 1783 CDS 100% 13.200 18.480 N SLITRK2 n/a
3 TRCN0000151924 CGTACTGAATATCAACTGTGA pLKO.1 637 CDS 100% 2.640 3.696 N SLITRK2 n/a
4 TRCN0000131107 GCCATGTTACAGTAGAGGGTA pLKO.1 7683 3UTR 100% 2.640 2.112 N TMEM257 n/a
5 TRCN0000431225 CAAGTCATCAAGGGCTTAATA pLKO_005 6371 3UTR 100% 15.000 10.500 N TMEM257 n/a
6 TRCN0000153670 CCAGCCTGTCATCAAATGATT pLKO.1 3754 3UTR 100% 5.625 3.938 N SLITRK2 n/a
7 TRCN0000157924 CCAGGCCGACTACAATTACAT pLKO.1 934 CDS 100% 5.625 3.938 N SLITRK2 n/a
8 TRCN0000157103 GCCACTGGGTATCACTACTTT pLKO.1 3566 3UTR 100% 5.625 3.938 N SLITRK2 n/a
9 TRCN0000151283 CAAGACTGTATCCAAACGAAT pLKO.1 741 CDS 100% 4.950 3.465 N SLITRK2 n/a
10 TRCN0000434731 CATCATATACTTTGAACCTTT pLKO_005 5805 3UTR 100% 4.950 3.465 N TMEM257 n/a
11 TRCN0000129671 CCCACTGACTATATTCTGTTT pLKO.1 5877 3UTR 100% 4.950 3.465 N TMEM257 n/a
12 TRCN0000129697 CTGCCAAGAACATATCTGTAT pLKO.1 6067 3UTR 100% 4.950 3.465 N TMEM257 n/a
13 TRCN0000156913 GCCTCTGACCTTTGATGCTTT pLKO.1 1906 CDS 100% 4.950 3.465 N SLITRK2 n/a
14 TRCN0000128555 GCTGGATATTGCTATTTCACT pLKO.1 5963 3UTR 100% 3.000 2.100 N TMEM257 n/a
15 TRCN0000153992 CCTTGAACATATTGGAGGGAT pLKO.1 1120 CDS 100% 2.640 1.848 N SLITRK2 n/a
16 TRCN0000152257 CAGACAATGGTCTGAATGTAA pLKO.1 1569 CDS 100% 0.563 0.394 N SLITRK2 n/a
17 TRCN0000130968 CATATCTGTATGTCTGGCCCT pLKO.1 6077 3UTR 100% 0.540 0.378 N TMEM257 n/a
18 TRCN0000128457 GCCAAGAACATATCTGTATGT pLKO.1 6069 3UTR 100% 0.495 0.347 N TMEM257 n/a
19 TRCN0000416973 ATTAGTTGCTTTCACTATTTC pLKO_005 6138 3UTR 100% 13.200 7.920 N TMEM257 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.