Transcript: Human NM_001144010.2

Homo sapiens SLIT and NTRK like family member 2 (SLITRK2), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
SLITRK2 (84631)
Length:
4144
CDS:
718..3255

Additional Resources:

NCBI RefSeq record:
NM_001144010.2
NBCI Gene record:
SLITRK2 (84631)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152771 GACCAGTTTACGCAGACTTTA pLKO.1 1983 CDS 100% 13.200 18.480 N SLITRK2 n/a
2 TRCN0000151924 CGTACTGAATATCAACTGTGA pLKO.1 837 CDS 100% 2.640 3.696 N SLITRK2 n/a
3 TRCN0000153670 CCAGCCTGTCATCAAATGATT pLKO.1 3954 3UTR 100% 5.625 3.938 N SLITRK2 n/a
4 TRCN0000157924 CCAGGCCGACTACAATTACAT pLKO.1 1134 CDS 100% 5.625 3.938 N SLITRK2 n/a
5 TRCN0000157103 GCCACTGGGTATCACTACTTT pLKO.1 3766 3UTR 100% 5.625 3.938 N SLITRK2 n/a
6 TRCN0000151283 CAAGACTGTATCCAAACGAAT pLKO.1 941 CDS 100% 4.950 3.465 N SLITRK2 n/a
7 TRCN0000156913 GCCTCTGACCTTTGATGCTTT pLKO.1 2106 CDS 100% 4.950 3.465 N SLITRK2 n/a
8 TRCN0000153992 CCTTGAACATATTGGAGGGAT pLKO.1 1320 CDS 100% 2.640 1.848 N SLITRK2 n/a
9 TRCN0000152257 CAGACAATGGTCTGAATGTAA pLKO.1 1769 CDS 100% 0.563 0.394 N SLITRK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.