Transcript: Human NM_001144764.2

Homo sapiens exophilin 5 (EXPH5), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
EXPH5 (23086)
Length:
9844
CDS:
241..5742

Additional Resources:

NCBI RefSeq record:
NM_001144764.2
NBCI Gene record:
EXPH5 (23086)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146332 CCTCTATCGTTCAAAGAGTTT pLKO.1 5142 CDS 100% 4.950 6.930 N EXPH5 n/a
2 TRCN0000146841 CTTATGAATTACCCAGCACAA pLKO.1 6110 3UTR 100% 4.050 5.670 N EXPH5 n/a
3 TRCN0000149785 CCAACTTGGATGACCTAGTAA pLKO.1 4502 CDS 100% 5.625 4.500 N EXPH5 n/a
4 TRCN0000146398 CCCTGATTCACTGTCTGATTT pLKO.1 6007 3UTR 100% 13.200 9.240 N EXPH5 n/a
5 TRCN0000128346 CCTGAATGCTAGAACAATGAA pLKO.1 5907 3UTR 100% 5.625 3.938 N EXPH5 n/a
6 TRCN0000128873 GCCAAGAGAAAGGACATTCTT pLKO.1 1217 CDS 100% 5.625 3.938 N EXPH5 n/a
7 TRCN0000128647 CCCAAACTAGAAGAAGTTCTT pLKO.1 4085 CDS 100% 4.950 3.465 N EXPH5 n/a
8 TRCN0000130133 CCGCACACAGATAAATCCAAT pLKO.1 2122 CDS 100% 4.950 3.465 N EXPH5 n/a
9 TRCN0000147076 CTACCATCAAAGCAACACATT pLKO.1 1122 CDS 100% 4.950 3.465 N EXPH5 n/a
10 TRCN0000150299 CTTCCAAGAATACACTGAGAA pLKO.1 3324 CDS 100% 4.950 3.465 N EXPH5 n/a
11 TRCN0000146784 CCGCTTAATATCTATGAGGAT pLKO.1 5635 CDS 100% 2.640 1.848 N EXPH5 n/a
12 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 7207 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.