Transcript: Human NM_001144869.3

Homo sapiens lipoyl(octanoyl) transferase 2 (LIPT2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
LIPT2 (387787)
Length:
2333
CDS:
22..717

Additional Resources:

NCBI RefSeq record:
NM_001144869.3
NBCI Gene record:
LIPT2 (387787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352426 CCAACTGAAGAGTACTCATAA pLKO_005 710 CDS 100% 13.200 18.480 N LIPT2 n/a
2 TRCN0000370817 GGCTAGACGATCGCAAGATCT pLKO_005 458 CDS 100% 4.950 6.930 N LIPT2 n/a
3 TRCN0000370816 TCTACCGACCTCACGTGGTTT pLKO_005 538 CDS 100% 4.950 3.960 N LIPT2 n/a
4 TRCN0000352432 ACCTTTCCTTGTGGCCTTTAA pLKO_005 651 CDS 100% 13.200 9.240 N LIPT2 n/a
5 TRCN0000352419 CACCTACTGAAACCCAGATTT pLKO_005 777 3UTR 100% 13.200 9.240 N LIPT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.