Transcript: Human NM_001144877.3

Homo sapiens suppressor of cancer cell invasion (SCAI), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
SCAI (286205)
Length:
12111
CDS:
92..1912

Additional Resources:

NCBI RefSeq record:
NM_001144877.3
NBCI Gene record:
SCAI (286205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144877.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424545 AGATTATACTCACCGATTTAA pLKO_005 721 CDS 100% 15.000 21.000 N SCAI n/a
2 TRCN0000161344 GCGGATCCTGTAATGGTATTA pLKO.1 800 CDS 100% 13.200 18.480 N SCAI n/a
3 TRCN0000158541 CGTCTAATAGTGTTGCGTATA pLKO.1 1395 CDS 100% 10.800 15.120 N SCAI n/a
4 TRCN0000162372 CACGTTCAATAGATCAGGCAT pLKO.1 1653 CDS 100% 2.640 3.696 N SCAI n/a
5 TRCN0000138330 CGGATGTTACAAGCTCTGGAA pLKO.1 986 CDS 100% 2.640 3.696 N SCAI n/a
6 TRCN0000419763 ATCATTGTGGATTCGTCTAAT pLKO_005 1382 CDS 100% 13.200 9.240 N SCAI n/a
7 TRCN0000426600 GAATACCATTGATGACTATTA pLKO_005 1891 CDS 100% 13.200 9.240 N SCAI n/a
8 TRCN0000160620 CCAGATGAATAAACCAGGAAT pLKO.1 1030 CDS 100% 4.950 3.465 N SCAI n/a
9 TRCN0000162404 CCCAGATGAATAAACCAGGAA pLKO.1 1029 CDS 100% 2.640 1.848 N SCAI n/a
10 TRCN0000159902 GTTAAGAGATTTGCCACAATA pLKO.1 316 CDS 100% 13.200 7.920 N SCAI n/a
11 TRCN0000159470 CACAAGTATCTGCTCTACAAA pLKO.1 1091 CDS 100% 5.625 3.375 N SCAI n/a
12 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3346 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
13 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 3907 3UTR 100% 10.800 5.400 Y MRPS16 n/a
14 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 9366 3UTR 100% 4.950 2.475 Y LOC387873 n/a
15 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 3907 3UTR 100% 10.800 5.400 Y CD3EAP n/a
16 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3452 3UTR 100% 5.625 2.813 Y KLHL30 n/a
17 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3768 3UTR 100% 2.640 1.320 Y LINC01098 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3452 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144877.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.