Transcript: Human NM_001144884.2

Homo sapiens solute carrier family 30 member 7 (SLC30A7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SLC30A7 (148867)
Length:
7888
CDS:
174..1304

Additional Resources:

NCBI RefSeq record:
NM_001144884.2
NBCI Gene record:
SLC30A7 (148867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042867 CCTGAACCTCTCTTTCGCTTT pLKO.1 302 CDS 100% 4.050 5.670 N SLC30A7 n/a
2 TRCN0000042864 GCCATGTCGATCATTGCCATA pLKO.1 736 CDS 100% 4.050 5.670 N SLC30A7 n/a
3 TRCN0000079628 GCCAGCATAGAAATGTACCAT pLKO.1 1612 3UTR 100% 3.000 4.200 N Slc30a7 n/a
4 TRCN0000419631 AGAGAATCTGTTGGAATATTA pLKO_005 1032 CDS 100% 15.000 10.500 N SLC30A7 n/a
5 TRCN0000425371 ACACAGTCATTCCCTCTTTAA pLKO_005 692 CDS 100% 13.200 9.240 N SLC30A7 n/a
6 TRCN0000042865 GCAACTGCTTAGGCTTGATTT pLKO.1 349 CDS 100% 13.200 9.240 N SLC30A7 n/a
7 TRCN0000042863 GCAGATCCTATCTGTTCAATT pLKO.1 969 CDS 100% 13.200 9.240 N SLC30A7 n/a
8 TRCN0000042866 GACTTTATGTTCTGACGTTTA pLKO.1 1154 CDS 100% 10.800 7.560 N SLC30A7 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1914 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1914 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.