Transcript: Human NM_001145095.1

Homo sapiens HERV-H LTR-associating 1 (HHLA1), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
HHLA1 (10086)
Length:
4105
CDS:
1..1596

Additional Resources:

NCBI RefSeq record:
NM_001145095.1
NBCI Gene record:
HHLA1 (10086)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145095.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141306 CCATGAACACTACAAGCCTTT pLKO.1 1088 CDS 100% 4.050 5.670 N HHLA1 n/a
2 TRCN0000142349 GAGGACATGAGATACTGTCTT pLKO.1 1459 CDS 100% 4.950 3.960 N HHLA1 n/a
3 TRCN0000144849 GACATGAGATACTGTCTTGAA pLKO.1 1462 CDS 100% 4.950 3.465 N HHLA1 n/a
4 TRCN0000139545 CAAACAGGTGATCTCTCTGCA pLKO.1 1234 CDS 100% 2.640 1.848 N HHLA1 n/a
5 TRCN0000141094 CATCAAGTTTCAAGGTGTCCT pLKO.1 1303 CDS 100% 2.640 1.848 N HHLA1 n/a
6 TRCN0000140901 CCAATTCTTCCAGCAATGCCT pLKO.1 1410 CDS 100% 0.750 0.525 N HHLA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145095.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.