Transcript: Human NM_001145161.3

Homo sapiens ubiquitin conjugating enzyme E2 Q family like 1 (UBE2QL1), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
UBE2QL1 (134111)
Length:
5895
CDS:
36..521

Additional Resources:

NCBI RefSeq record:
NM_001145161.3
NBCI Gene record:
UBE2QL1 (134111)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145161.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336877 TTCGGATTATGTTTCGATTAT pLKO_005 709 3UTR 100% 13.200 18.480 N UBE2QL1 n/a
2 TRCN0000350833 AGGAAGCTGAAGCTACCTTTA pLKO_005 439 CDS 100% 10.800 7.560 N UBE2QL1 n/a
3 TRCN0000350834 GTTTGGTGAAGACGCATGAAA pLKO_005 463 CDS 100% 5.625 3.938 N UBE2QL1 n/a
4 TRCN0000350775 GGAGACCAACACCGAGTTCAT pLKO_005 170 CDS 100% 4.950 3.465 N UBE2QL1 n/a
5 TRCN0000336876 CCTGTTCGACTGGAACGTGAA pLKO_005 104 CDS 100% 4.050 2.835 N UBE2QL1 n/a
6 TRCN0000092481 GAGGCCGTCATGCGCCAGTTT pLKO.1 345 CDS 100% 0.000 0.000 N Ube2ql1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145161.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.