Transcript: Human NM_001145167.1

Homo sapiens protein arginine methyltransferase 3 (PRMT3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
PRMT3 (10196)
Length:
2607
CDS:
313..1677

Additional Resources:

NCBI RefSeq record:
NM_001145167.1
NBCI Gene record:
PRMT3 (10196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034570 CCTTGTGGTATTAAGCATATA pLKO.1 1327 CDS 100% 13.200 18.480 N PRMT3 n/a
2 TRCN0000299321 CCTTGTGGTATTAAGCATATA pLKO_005 1327 CDS 100% 13.200 18.480 N PRMT3 n/a
3 TRCN0000379742 GACGTTTGCTCCACCAGATTT pLKO_005 1897 3UTR 100% 13.200 18.480 N PRMT3 n/a
4 TRCN0000034572 GCAGTGAGTGATGTGAATAAA pLKO.1 1186 CDS 100% 15.000 10.500 N PRMT3 n/a
5 TRCN0000299322 GCAGTGAGTGATGTGAATAAA pLKO_005 1186 CDS 100% 15.000 10.500 N PRMT3 n/a
6 TRCN0000034571 GCTGGCTACTTTGATATATAT pLKO.1 1435 CDS 100% 15.000 10.500 N PRMT3 n/a
7 TRCN0000034573 CGTGACCCTCACGTTGAATAA pLKO.1 1629 CDS 100% 13.200 9.240 N PRMT3 n/a
8 TRCN0000299323 CGTGACCCTCACGTTGAATAA pLKO_005 1629 CDS 100% 13.200 9.240 N PRMT3 n/a
9 TRCN0000380837 TGGTCTGCCACGTAATCATTT pLKO_005 1871 3UTR 100% 13.200 9.240 N PRMT3 n/a
10 TRCN0000034569 CCTTGGGAGAAAGAAGAGTAT pLKO.1 421 CDS 100% 4.950 3.465 N PRMT3 n/a
11 TRCN0000299324 CCTTGGGAGAAAGAAGAGTAT pLKO_005 421 CDS 100% 4.950 3.465 N PRMT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.