Transcript: Human NM_001145194.2

Homo sapiens A-kinase anchor inhibitor 1 (AKAIN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
AKAIN1 (642597)
Length:
3065
CDS:
205..414

Additional Resources:

NCBI RefSeq record:
NM_001145194.2
NBCI Gene record:
AKAIN1 (642597)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337282 GGTTCAGGTCTAAGATCAAAT pLKO_005 894 3UTR 100% 13.200 18.480 N AKAIN1 n/a
2 TRCN0000377650 AGTTAACCAAGAAGCACGAAA pLKO_005 386 CDS 100% 4.950 6.930 N AKAIN1 n/a
3 TRCN0000371118 CTAGCCTTCCTCTTAGTATAG pLKO_005 450 3UTR 100% 10.800 7.560 N AKAIN1 n/a
4 TRCN0000337280 ATTGTGCAGAATGCAATCCTG pLKO_005 277 CDS 100% 2.640 1.848 N AKAIN1 n/a
5 TRCN0000371061 TGCAATCCTGCAAGCTGTGCA pLKO_005 288 CDS 100% 2.640 1.848 N AKAIN1 n/a
6 TRCN0000337279 AGAAGTAACATGGTGGATTTG pLKO_005 407 CDS 100% 10.800 6.480 N AKAIN1 n/a
7 TRCN0000337281 AGCTGCAGAATGCCAGCAAAC pLKO_005 254 CDS 100% 6.000 3.600 N AKAIN1 n/a
8 TRCN0000377625 ATGAGCCTGAAGAGGTGAAGC pLKO_005 236 CDS 100% 4.050 2.430 N AKAIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.