Transcript: Human NM_001145312.3

Homo sapiens ETS variant transcription factor 3 (ETV3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-26
Taxon:
Homo sapiens (human)
Gene:
ETV3 (2117)
Length:
5282
CDS:
94..1632

Additional Resources:

NCBI RefSeq record:
NM_001145312.3
NBCI Gene record:
ETV3 (2117)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235860 CAACAAGAGGATCCTTCATAA pLKO_005 387 CDS 100% 13.200 9.240 N Etv3 n/a
2 TRCN0000235863 GAGGTGGAGGGTATCAGTTTC pLKO_005 131 CDS 100% 10.800 7.560 N Etv3 n/a
3 TRCN0000420290 TTTCCTGACTGGGCCTACAAA pLKO_005 148 CDS 100% 5.625 3.938 N ETV3 n/a
4 TRCN0000417535 AGAAGGAGGTGGAGGGTATCA pLKO_005 126 CDS 100% 4.950 3.465 N ETV3 n/a
5 TRCN0000086569 CCCTCAGATACTATTACAACA pLKO.1 371 CDS 100% 4.950 3.465 N Etv3 n/a
6 TRCN0000013929 CCTCAGATACTATTACAACAA pLKO.1 372 CDS 100% 4.950 3.465 N ETV3 n/a
7 TRCN0000013932 GCCCAACTACCCATTCATCAA pLKO.1 459 CDS 100% 4.950 2.970 N ETV3 n/a
8 TRCN0000013931 GAAATGCAAACCACAGATGAA pLKO.1 330 CDS 100% 4.950 2.475 Y ETV3 n/a
9 TRCN0000086571 CGGTTCCATTTCCCACCTCTA pLKO.1 538 CDS 100% 4.050 2.835 N Etv3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.