Transcript: Human NM_001145543.1

Homo sapiens zinc finger and SCAN domain containing 18 (ZSCAN18), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
ZSCAN18 (65982)
Length:
2716
CDS:
310..1842

Additional Resources:

NCBI RefSeq record:
NM_001145543.1
NBCI Gene record:
ZSCAN18 (65982)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232308 TCGCGTGTGTTTACCTATATG pLKO_005 2340 3UTR 100% 13.200 18.480 N ZSCAN18 n/a
2 TRCN0000232307 AGAGAAGCAAAGACCGAAGAG pLKO_005 907 CDS 100% 4.050 5.670 N ZSCAN18 n/a
3 TRCN0000016638 CGGGCTCATCCTCAATTCTTA pLKO.1 734 CDS 100% 5.625 4.500 N ZSCAN18 n/a
4 TRCN0000016640 TGGAAAGAGATCCACAAGGAA pLKO.1 1115 CDS 100% 3.000 2.400 N ZSCAN18 n/a
5 TRCN0000016642 CGCGTGGCTCTCGCACCTGAT pLKO.1 1575 CDS 100% 0.000 0.000 N ZSCAN18 n/a
6 TRCN0000232306 GGGCTCATCCTCAATTCTTAG pLKO_005 735 CDS 100% 10.800 7.560 N ZSCAN18 n/a
7 TRCN0000016639 CGCCTGCGTTTCCGGGAATTT pLKO.1 454 CDS 100% 4.400 3.080 N ZSCAN18 n/a
8 TRCN0000232304 CGCCTGCGTTTCCGGGAATTT pLKO_005 454 CDS 100% 4.400 3.080 N ZSCAN18 n/a
9 TRCN0000016641 GCACCAGAAGACCCACGAGAA pLKO.1 1683 CDS 100% 1.350 0.945 N ZSCAN18 n/a
10 TRCN0000232305 GTACCCTGAGAGCTGCAAGAA pLKO_005 645 CDS 100% 0.000 0.000 N ZSCAN18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.