Transcript: Human NM_001145657.3

Homo sapiens RAP1 GTPase activating protein (RAP1GAP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RAP1GAP (5909)
Length:
3483
CDS:
360..2405

Additional Resources:

NCBI RefSeq record:
NM_001145657.3
NBCI Gene record:
RAP1GAP (5909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145657.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296344 ACTTCAAGTTTGGCGTCATTT pLKO_005 934 CDS 100% 13.200 9.240 N RAP1GAP n/a
2 TRCN0000296343 AGCACAAGGAGGATGTGATAT pLKO_005 2812 3UTR 100% 13.200 9.240 N RAP1GAP n/a
3 TRCN0000296404 GGTCAAACTGCAGGACTTTAA pLKO_005 1049 CDS 100% 13.200 9.240 N RAP1GAP n/a
4 TRCN0000073363 CCTGCCTTAGAAGGTAGGATT pLKO.1 2987 3UTR 100% 4.950 3.465 N RAP1GAP n/a
5 TRCN0000073364 GCTTTCGTGGAGTTCCTTGAA pLKO.1 1014 CDS 100% 4.950 3.465 N RAP1GAP n/a
6 TRCN0000333800 GCTTTCGTGGAGTTCCTTGAA pLKO_005 1014 CDS 100% 4.950 3.465 N RAP1GAP n/a
7 TRCN0000073365 CAATGCTGAATATGCCTGCTA pLKO.1 1469 CDS 100% 2.640 1.848 N RAP1GAP n/a
8 TRCN0000222545 CCACCTTGTCTTCTCACTCAA pLKO.1 689 CDS 100% 4.950 2.970 N RAP1GAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145657.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.