Transcript: Mouse NM_001145802.1

Mus musculus male germ cell-associated kinase (Mak), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mak (17152)
Length:
3274
CDS:
334..1986

Additional Resources:

NCBI RefSeq record:
NM_001145802.1
NBCI Gene record:
Mak (17152)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009770 GCTGGAGGCAAGGATATAAAT pLKO.1 1729 CDS 100% 15.000 10.500 N Mak n/a
2 TRCN0000432479 GTGAAGTTGATGAGATCTTTA pLKO_005 851 CDS 100% 13.200 9.240 N Mak n/a
3 TRCN0000427912 CAGACTGGGTGGCTAAGTATG pLKO_005 1952 CDS 100% 10.800 7.560 N Mak n/a
4 TRCN0000009768 CCTTTCCTTCAAGAGGAGTAA pLKO.1 1806 CDS 100% 4.950 3.465 N Mak n/a
5 TRCN0000009771 GACGACATTGAGGACGACTTA pLKO.1 1462 CDS 100% 4.950 3.465 N Mak n/a
6 TRCN0000009769 GCGAGAAGTTAAGTCCCTGAA pLKO.1 477 CDS 100% 4.050 2.430 N Mak n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.