Transcript: Human NM_001145850.2

Homo sapiens prominin 1 (PROM1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
PROM1 (8842)
Length:
3919
CDS:
250..2754

Additional Resources:

NCBI RefSeq record:
NM_001145850.2
NBCI Gene record:
PROM1 (8842)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418018 GTGTACAGTAAACGGTGTATA pLKO_005 3180 3UTR 100% 13.200 18.480 N PROM1 n/a
2 TRCN0000416340 TGTGGTACAGCCGCGTGATTT pLKO_005 441 CDS 100% 13.200 18.480 N PROM1 n/a
3 TRCN0000062144 GCGTCTTCCTATTCAGGATAT pLKO.1 1443 CDS 100% 10.800 15.120 N PROM1 n/a
4 TRCN0000424799 CAGAACTTGACAACGTTAATA pLKO_005 1268 CDS 100% 15.000 10.500 N PROM1 n/a
5 TRCN0000062143 CCCAACATCATCCCTGTTCTT pLKO.1 988 CDS 100% 4.950 3.465 N PROM1 n/a
6 TRCN0000062145 CCTCTGTTATTATTGAGGAAA pLKO.1 2444 CDS 100% 4.950 3.465 N PROM1 n/a
7 TRCN0000062146 GCAACAAATTATGAGACCCAA pLKO.1 361 CDS 100% 2.640 1.848 N PROM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.