Transcript: Mouse NM_001146048.1

Mus musculus leucine rich repeat containing 1 (Lrrc1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Lrrc1 (214345)
Length:
3103
CDS:
230..1804

Additional Resources:

NCBI RefSeq record:
NM_001146048.1
NBCI Gene record:
Lrrc1 (214345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001146048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111141 CCGGAATGATATACCTGAAAT pLKO.1 499 CDS 100% 13.200 18.480 N Lrrc1 n/a
2 TRCN0000111142 CGGAGTTAGTTCTTACAGAAA pLKO.1 1104 CDS 100% 4.950 6.930 N Lrrc1 n/a
3 TRCN0000111144 GCACTCCTACATCTGAAGGAT pLKO.1 812 CDS 100% 3.000 4.200 N Lrrc1 n/a
4 TRCN0000425732 AGACTAGAAGAACTTGATTTA pLKO_005 752 CDS 100% 13.200 9.240 N LRRC1 n/a
5 TRCN0000111140 CCGTCCTAATTCTGTTCAATA pLKO.1 1975 3UTR 100% 13.200 9.240 N Lrrc1 n/a
6 TRCN0000146591 CATATCTTCCTGACTCTCTTA pLKO.1 720 CDS 100% 4.950 3.465 N LRRC1 n/a
7 TRCN0000111143 CCTGACTCTCTTACCCAACTA pLKO.1 728 CDS 100% 4.950 3.465 N Lrrc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.