Transcript: Mouse NM_001146086.1

Mus musculus F-box protein 34 (Fbxo34), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fbxo34 (78938)
Length:
3055
CDS:
278..2365

Additional Resources:

NCBI RefSeq record:
NM_001146086.1
NBCI Gene record:
Fbxo34 (78938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001146086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250691 CAGCCGGGATGACGTAGAAAT pLKO_005 1468 CDS 100% 13.200 18.480 N Fbxo34 n/a
2 TRCN0000250692 CAGATGCTGTCCGTCGCATAA pLKO_005 1515 CDS 100% 10.800 15.120 N Fbxo34 n/a
3 TRCN0000250694 ATGGTGGTGCCTCACATTAAA pLKO_005 2530 3UTR 100% 15.000 12.000 N Fbxo34 n/a
4 TRCN0000250690 ATCGATGGGAGAGCCACTAAA pLKO_005 701 CDS 100% 13.200 10.560 N Fbxo34 n/a
5 TRCN0000192794 GCATAAGAAGAGAGCTTGTAA pLKO.1 1530 CDS 100% 5.625 4.500 N Fbxo34 n/a
6 TRCN0000250693 CGGGAGCTTGTCACGCAATAA pLKO_005 1171 CDS 100% 13.200 9.240 N Fbxo34 n/a
7 TRCN0000192990 GCTAGAAATGATGAGAGAGAT pLKO.1 763 CDS 100% 4.950 3.465 N Fbxo34 n/a
8 TRCN0000202321 GCTGTACTGGAAACTCCAGAA pLKO.1 289 CDS 100% 4.050 2.835 N Fbxo34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.