Transcript: Mouse NM_001146296.1

Mus musculus adenosine deaminase, RNA-specific (Adar), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Adar (56417)
Length:
5928
CDS:
94..3630

Additional Resources:

NCBI RefSeq record:
NM_001146296.1
NBCI Gene record:
Adar (56417)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001146296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234067 GTCCCATGAACCTCGATTTAA pLKO_005 1539 CDS 100% 15.000 21.000 N Adar n/a
2 TRCN0000071314 CGTCCCATGAACCTCGATTTA pLKO.1 1538 CDS 100% 13.200 18.480 N Adar n/a
3 TRCN0000234069 ATGGACTACGCTATCCCTTTA pLKO_005 3218 CDS 100% 10.800 15.120 N Adar n/a
4 TRCN0000218395 GTGAATCCAGATAGTTGTATC pLKO_005 730 CDS 100% 10.800 8.640 N Adar n/a
5 TRCN0000234070 TTAATGGTAGAACCATAATAG pLKO_005 3730 3UTR 100% 13.200 9.240 N Adar n/a
6 TRCN0000071313 CCCAGATAACTTGAATAGTAT pLKO.1 1329 CDS 100% 5.625 3.938 N Adar n/a
7 TRCN0000071315 GCCGAGTCAGTGTTTATGATT pLKO.1 3260 CDS 100% 5.625 3.938 N Adar n/a
8 TRCN0000071317 GCTCTCTTATGGTGAAGCCAA pLKO.1 3477 CDS 100% 2.640 1.848 N Adar n/a
9 TRCN0000234068 ACTGCCAAGAACAGCATATTT pLKO_005 2740 CDS 100% 15.000 9.000 N Adar n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.