Transcript: Mouse NM_001146311.2

Mus musculus ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) (Cln3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Cln3 (12752)
Length:
3203
CDS:
827..2143

Additional Resources:

NCBI RefSeq record:
NM_001146311.2
NBCI Gene record:
Cln3 (12752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001146311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305292 TCACGTCTGACTGGGATATAC pLKO_005 2468 3UTR 100% 13.200 18.480 N Cln3 n/a
2 TRCN0000106512 CGTGAATACCTTCCACAACAT pLKO.1 1993 CDS 100% 4.950 6.930 N Cln3 n/a
3 TRCN0000305234 CTGCTGCTAGCCAGCTATTTC pLKO_005 1490 CDS 100% 13.200 10.560 N Cln3 n/a
4 TRCN0000311269 GTGACAAGCACCGAGAGTTTG pLKO_005 2028 CDS 100% 10.800 8.640 N Cln3 n/a
5 TRCN0000305291 TCTTGGGTCTTTGCAACAATT pLKO_005 954 CDS 100% 13.200 9.240 N Cln3 n/a
6 TRCN0000106510 GCCCTTCTAATAAATGCTTAT pLKO.1 2294 3UTR 100% 10.800 7.560 N Cln3 n/a
7 TRCN0000106513 CCACAACAGCTCATCTCGATT pLKO.1 1075 CDS 100% 4.950 3.465 N Cln3 n/a
8 TRCN0000334368 CCACAACAGCTCATCTCGATT pLKO_005 1075 CDS 100% 4.950 3.465 N Cln3 n/a
9 TRCN0000106511 GCTTCTTGGATCGCTGTCTTA pLKO.1 1402 CDS 100% 4.950 3.465 N Cln3 n/a
10 TRCN0000106514 CTTCTCTCCAATGTTGCCGAA pLKO.1 1830 CDS 100% 2.160 1.512 N Cln3 n/a
11 TRCN0000083021 GCTATTTCTTGTTGCTCACAT pLKO.1 1503 CDS 100% 4.950 3.465 N CLN3 n/a
12 TRCN0000290460 GCTATTTCTTGTTGCTCACAT pLKO_005 1503 CDS 100% 4.950 3.465 N CLN3 n/a
13 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 2427 3UTR 100% 4.950 2.475 Y CENPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.