Transcript: Human NM_001146686.3

Homo sapiens geminin coiled-coil domain containing (GMNC), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GMNC (647309)
Length:
3642
CDS:
80..1084

Additional Resources:

NCBI RefSeq record:
NM_001146686.3
NBCI Gene record:
GMNC (647309)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146686.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337200 AGCCTTTGTGCGTCGAGATGA pLKO_005 1021 CDS 100% 4.950 6.930 N GMNC n/a
2 TRCN0000337202 TCCTTACTATACTGCTCATGT pLKO_005 916 CDS 100% 4.950 6.930 N GMNC n/a
3 TRCN0000337143 ATCCTTTCTCAACTTTCAAAT pLKO_005 872 CDS 100% 13.200 9.240 N GMNC n/a
4 TRCN0000337138 TCCCTGAGCCCTCATTGTAAT pLKO_005 971 CDS 100% 13.200 9.240 N GMNC n/a
5 TRCN0000337215 GCCACTCATGGAGAAGATTTC pLKO_005 848 CDS 100% 10.800 7.560 N GMNC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146686.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.