Transcript: Human NM_001146706.2

Homo sapiens lysine demethylase 5D (KDM5D), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
KDM5D (8284)
Length:
6654
CDS:
76..4524

Additional Resources:

NCBI RefSeq record:
NM_001146706.2
NBCI Gene record:
KDM5D (8284)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359189 CCTCGCGTCCAAAGGCTAAAT pLKO_005 274 CDS 100% 13.200 18.480 N KDM5D n/a
2 TRCN0000234753 GAGAAGGCAGTGGCAACAATA pLKO_005 3875 CDS 100% 13.200 18.480 N KDM5D n/a
3 TRCN0000022117 CGCGTCCAAAGGCTAAATGAA pLKO.1 277 CDS 100% 5.625 7.875 N KDM5D n/a
4 TRCN0000022115 GCCACATTGGAAGCCATAATT pLKO.1 2863 CDS 100% 15.000 12.000 N KDM5D n/a
5 TRCN0000234752 CCACATTGGAAGCCATAATTC pLKO_005 2864 CDS 100% 13.200 10.560 N KDM5D n/a
6 TRCN0000359116 GCCGAGAAGAAGAACATTATC pLKO_005 4334 CDS 100% 13.200 9.240 N KDM5D n/a
7 TRCN0000359115 GCTAGCATACAGGAGTGATTT pLKO_005 4736 3UTR 100% 13.200 9.240 N KDM5D n/a
8 TRCN0000234751 TGTATCTTGGCGGAGTGTAAA pLKO_005 985 CDS 100% 13.200 9.240 N KDM5D n/a
9 TRCN0000359113 TTGCAGTAGAAGTTGACAATT pLKO_005 242 CDS 100% 13.200 9.240 N KDM5D n/a
10 TRCN0000234754 AGTGGCACCAAAGGTCATTTG pLKO_005 4526 3UTR 100% 10.800 7.560 N KDM5D n/a
11 TRCN0000359188 GACCTCTACAGCCTTAGTAAG pLKO_005 406 CDS 100% 10.800 7.560 N KDM5D n/a
12 TRCN0000359117 GGGAACGTGTCATCAACATTG pLKO_005 739 CDS 100% 10.800 7.560 N KDM5D n/a
13 TRCN0000022116 CCAGTGCTAGATCAGTCTGTT pLKO.1 1312 CDS 100% 4.950 3.465 N KDM5D n/a
14 TRCN0000234750 CCAGTTTATTGACTCATATAT pLKO_005 831 CDS 100% 15.000 9.000 N KDM5D n/a
15 TRCN0000359186 CTAGAGTGAAATTGAACTATT pLKO_005 311 CDS 100% 13.200 7.920 N KDM5D n/a
16 TRCN0000022118 CAGCCCTTTCTTGAAAGGAAA pLKO.1 4404 CDS 100% 0.495 0.297 N KDM5D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.