Transcript: Mouse NM_001159523.1

Mus musculus src homology 2 domain-containing transforming protein D (Shd), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Shd (20420)
Length:
1551
CDS:
287..1321

Additional Resources:

NCBI RefSeq record:
NM_001159523.1
NBCI Gene record:
Shd (20420)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193253 CAGCTTTACGATACTCCATAT pLKO.1 695 CDS 100% 10.800 15.120 N Shd n/a
2 TRCN0000173482 GAGTGGAAGAAGGATCACATC pLKO.1 815 CDS 100% 4.050 2.835 N Shd n/a
3 TRCN0000175841 GAAGCAGAAACTGAGTACTCA pLKO.1 572 CDS 100% 3.000 2.100 N Shd n/a
4 TRCN0000173137 CAAGTACAACTCTCCTAGGCA pLKO.1 475 CDS 100% 0.750 0.525 N Shd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.