Transcript: Mouse NM_001159538.1

Mus musculus FYVE, RhoGEF and PH domain containing 2 (Fgd2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fgd2 (26382)
Length:
2634
CDS:
180..2150

Additional Resources:

NCBI RefSeq record:
NM_001159538.1
NBCI Gene record:
Fgd2 (26382)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110044 TGATGTCTATACCGAGACAAT pLKO.1 2249 3UTR 100% 0.495 0.693 N Fgd2 n/a
2 TRCN0000376827 TACCGTGCGGAGCTGAAATAT pLKO_005 1665 CDS 100% 0.000 0.000 N Fgd2 n/a
3 TRCN0000366961 CATAAACTGGGCATGGTAATA pLKO_005 2461 3UTR 100% 13.200 9.240 N Fgd2 n/a
4 TRCN0000366907 GAACTGCTGCTCAAGGAATAT pLKO_005 939 CDS 100% 13.200 9.240 N Fgd2 n/a
5 TRCN0000366962 TTCCCTCAAGAACAAGTTATC pLKO_005 401 CDS 100% 10.800 7.560 N Fgd2 n/a
6 TRCN0000375910 AGAAGCACCTGGATCCCATAG pLKO_005 257 CDS 100% 6.000 4.200 N Fgd2 n/a
7 TRCN0000375916 TGAGGGACCTGACGAAGAAGA pLKO_005 2117 CDS 100% 4.950 3.465 N Fgd2 n/a
8 TRCN0000110040 TGCCCATCTAACATGGATGAA pLKO.1 2415 3UTR 100% 4.950 3.465 N Fgd2 n/a
9 TRCN0000110042 GCTACACATTTCTCACTGGAA pLKO.1 1720 CDS 100% 2.640 1.848 N Fgd2 n/a
10 TRCN0000110041 CTGATGTCTATACCGAGACAA pLKO.1 2248 3UTR 100% 0.495 0.347 N Fgd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.