Transcript: Human NM_001159576.2

Homo sapiens sodium channel epithelial 1 alpha subunit (SCNN1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SCNN1A (6337)
Length:
3703
CDS:
491..2677

Additional Resources:

NCBI RefSeq record:
NM_001159576.2
NBCI Gene record:
SCNN1A (6337)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044560 GAACAATTACACCGTCAACAA pLKO.1 2194 CDS 100% 4.950 6.930 N SCNN1A n/a
2 TRCN0000291511 GAACAATTACACCGTCAACAA pLKO_005 2194 CDS 100% 4.950 6.930 N SCNN1A n/a
3 TRCN0000331102 CTCCTGCAACCAGGCGAATTA pLKO_005 1528 CDS 100% 13.200 10.560 N SCNN1A n/a
4 TRCN0000044562 CGCAGAGCAGAATGACTTCAT pLKO.1 1666 CDS 100% 4.950 3.960 N SCNN1A n/a
5 TRCN0000291449 CGCAGAGCAGAATGACTTCAT pLKO_005 1666 CDS 100% 4.950 3.960 N SCNN1A n/a
6 TRCN0000296934 TTCCTAAGAAACCGCTGATAA pLKO_005 3000 3UTR 100% 13.200 9.240 N SCNN1A n/a
7 TRCN0000044559 CGATGTATGGAAACTGCTATA pLKO.1 1566 CDS 100% 10.800 7.560 N SCNN1A n/a
8 TRCN0000291450 CGATGTATGGAAACTGCTATA pLKO_005 1566 CDS 100% 10.800 7.560 N SCNN1A n/a
9 TRCN0000044558 CCAGAACAAATCGGACTGCTT pLKO.1 1357 CDS 100% 2.640 1.848 N SCNN1A n/a
10 TRCN0000044561 CCCGGAAATTAAAGAGGAGCT pLKO.1 1087 CDS 100% 2.160 1.512 N SCNN1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.