Transcript: Mouse NM_001159599.2

Mus musculus nucleolar protein 9 (Nol9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nol9 (74035)
Length:
3756
CDS:
35..2179

Additional Resources:

NCBI RefSeq record:
NM_001159599.2
NBCI Gene record:
Nol9 (74035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413134 ACGAGAATTACATTGACATAG pLKO_005 1230 CDS 100% 10.800 15.120 N Nol9 n/a
2 TRCN0000178324 GAGAAAGAGTCTAGTCCACTT pLKO.1 1529 CDS 100% 4.050 3.240 N Nol9 n/a
3 TRCN0000198077 CGCTTTACTTACCATCACAGA pLKO.1 1126 CDS 100% 2.640 2.112 N Nol9 n/a
4 TRCN0000419293 TTATATTCTGATCGCTGTAAA pLKO_005 1382 CDS 100% 13.200 9.240 N Nol9 n/a
5 TRCN0000198234 GACCTATAAGTGCTCCTCATA pLKO.1 799 CDS 100% 4.950 3.465 N Nol9 n/a
6 TRCN0000198347 GTTCGGGTCAATTCTGAGTTT pLKO.1 845 CDS 100% 4.950 3.465 N Nol9 n/a
7 TRCN0000198836 CAGAGGCATTGACATGGACAA pLKO.1 1918 CDS 100% 4.050 2.835 N Nol9 n/a
8 TRCN0000099330 CCTGAGTTCAATTCCCAACAA pLKO.1 3607 3UTR 100% 4.950 2.475 Y Mrpl27 n/a
9 TRCN0000332277 CCTGAGTTCAATTCCCAACAA pLKO_005 3607 3UTR 100% 4.950 2.475 Y Mrpl27 n/a
10 TRCN0000138943 GCCCTGGAAGAGTTAGTCAAT pLKO.1 941 CDS 100% 4.950 3.465 N NOL9 n/a
11 TRCN0000338728 GCCCTGGAAGAGTTAGTCAAT pLKO_005 941 CDS 100% 4.950 3.465 N NOL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.