Transcript: Mouse NM_001159620.1

Mus musculus phosphatidylinositol glycan anchor biosynthesis, class P (Pigp), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pigp (56176)
Length:
846
CDS:
62..481

Additional Resources:

NCBI RefSeq record:
NM_001159620.1
NBCI Gene record:
Pigp (56176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276477 TTGCCAGAAAGAGCGATTTAT pLKO_005 185 CDS 100% 15.000 21.000 N PIGP n/a
2 TRCN0000124345 CCTCCTTATCACAGTTGTAAT pLKO.1 343 CDS 100% 13.200 18.480 N Pigp n/a
3 TRCN0000326211 CCTCCTTATCACAGTTGTAAT pLKO_005 343 CDS 100% 13.200 18.480 N Pigp n/a
4 TRCN0000124347 CGTTCCCGAATCTTGGTTAAA pLKO.1 265 CDS 100% 13.200 18.480 N Pigp n/a
5 TRCN0000326214 CGTTCCCGAATCTTGGTTAAA pLKO_005 265 CDS 100% 13.200 18.480 N Pigp n/a
6 TRCN0000086494 CGAAGAACTTATCGAGGTCTT pLKO.1 503 3UTR 100% 4.050 2.025 Y Dppa5a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.