Transcript: Mouse NM_001159638.1

Mus musculus thioesterase superfamily member 7 (Them7), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Them7 (74088)
Length:
1513
CDS:
62..661

Additional Resources:

NCBI RefSeq record:
NM_001159638.1
NBCI Gene record:
Them7 (74088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182656 GCCACCCTAAATTAGCACAGT pLKO.1 516 CDS 100% 2.640 3.696 N Them7 n/a
2 TRCN0000178448 GTCAATCACCATGATCTCATT pLKO.1 479 CDS 100% 4.950 3.960 N Them7 n/a
3 TRCN0000178502 CCATGATCTCATTGATGGTTT pLKO.1 487 CDS 100% 4.950 3.465 N Them7 n/a
4 TRCN0000178582 CCCTAAATTAGCACAGTTTGA pLKO.1 520 CDS 100% 4.950 3.465 N Them7 n/a
5 TRCN0000182276 GAAGCTGATGAGTCCAGCATA pLKO.1 640 CDS 100% 4.950 3.465 N Them7 n/a
6 TRCN0000178270 GCCTTTGAAATGGTTGTCAAT pLKO.1 764 3UTR 100% 4.950 3.465 N Them7 n/a
7 TRCN0000177861 CCAATATCTTATCAGCAGGTT pLKO.1 1158 3UTR 100% 2.640 1.848 N Them7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.